ID: 1002535737_1002535744

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1002535737 1002535744
Species Human (GRCh38) Human (GRCh38)
Location 5:179874422-179874444 5:179874461-179874483
Sequence CCTGGACATTTGGCGTGACTAGT CAGCTGTTCCAGCGGGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31} {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!