ID: 1002536666_1002536679

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1002536666 1002536679
Species Human (GRCh38) Human (GRCh38)
Location 5:179879684-179879706 5:179879734-179879756
Sequence CCTGGGATGCGGTTGGCGCCTCC AGGGGAGAGGCTGGGCTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87} {0: 1, 1: 0, 2: 22, 3: 119, 4: 1146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!