ID: 1002536961_1002536970

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1002536961 1002536970
Species Human (GRCh38) Human (GRCh38)
Location 5:179881096-179881118 5:179881137-179881159
Sequence CCAACGTGTGCTCCTGGCGAGGC CTCAGGGACCAGGCGGCTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148} {0: 1, 1: 0, 2: 0, 3: 17, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!