ID: 1002540394_1002540411

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1002540394 1002540411
Species Human (GRCh38) Human (GRCh38)
Location 5:179902780-179902802 5:179902833-179902855
Sequence CCCACAGGAAGCCCCTCCTCTGG GGCTCTGAAGCCAGAGATCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 267} {0: 1, 1: 1, 2: 0, 3: 41, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!