ID: 1002554077_1002554082

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1002554077 1002554082
Species Human (GRCh38) Human (GRCh38)
Location 5:180020590-180020612 5:180020634-180020656
Sequence CCAAGGGTCTTCTCTTCTTTCTT ATCACATACAAGTAGGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 744} {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!