ID: 1002564194_1002564209

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1002564194 1002564209
Species Human (GRCh38) Human (GRCh38)
Location 5:180100716-180100738 5:180100765-180100787
Sequence CCATGCCTGAACTGTGGCTACAG GCCATGGGGTGGACGTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 185} {0: 1, 1: 0, 2: 1, 3: 45, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!