ID: 1002567048_1002567055

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1002567048 1002567055
Species Human (GRCh38) Human (GRCh38)
Location 5:180118155-180118177 5:180118204-180118226
Sequence CCTCAATTTTATCTGAAACAGAA GGGACCAAAGGGCCCCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 493} {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!