ID: 1002575378_1002575400

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1002575378 1002575400
Species Human (GRCh38) Human (GRCh38)
Location 5:180171106-180171128 5:180171153-180171175
Sequence CCTGTGGCCTTCCCCCAGCCCAG ATCTTCAGGGGGAAGGAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 2, 3: 37, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!