ID: 1002578852_1002578857

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1002578852 1002578857
Species Human (GRCh38) Human (GRCh38)
Location 5:180195047-180195069 5:180195063-180195085
Sequence CCCAGTGCCTGCTGCAGAGAACA GAGAACAGCCTGGAGTTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 314} {0: 1, 1: 0, 2: 3, 3: 24, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!