ID: 1002580960_1002580974

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1002580960 1002580974
Species Human (GRCh38) Human (GRCh38)
Location 5:180209199-180209221 5:180209241-180209263
Sequence CCCGGAGCAACGCGGCGCTGCGC AGCGCGGAGCGGGCGGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76} {0: 1, 1: 1, 2: 10, 3: 115, 4: 884}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!