ID: 1002593065_1002593081

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1002593065 1002593081
Species Human (GRCh38) Human (GRCh38)
Location 5:180304466-180304488 5:180304511-180304533
Sequence CCTGGGGAAACCCTGCCCCAGGG CTGAGCTCCAGGCTAGGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 389} {0: 1, 1: 0, 2: 2, 3: 17, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!