ID: 1002596567_1002596574

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1002596567 1002596574
Species Human (GRCh38) Human (GRCh38)
Location 5:180327626-180327648 5:180327660-180327682
Sequence CCCCAGGGCCCAGCACACAGTAA ATATTAGTTGCATGGTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 21, 3: 141, 4: 735} {0: 1, 1: 0, 2: 3, 3: 22, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!