ID: 1002599918_1002599930

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1002599918 1002599930
Species Human (GRCh38) Human (GRCh38)
Location 5:180348262-180348284 5:180348295-180348317
Sequence CCCGAGCGTGTGCACGTGTGTGC CTGTGTGTGTTGGGGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 318} {0: 1, 1: 2, 2: 33, 3: 200, 4: 1093}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!