ID: 1002605332_1002605339

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1002605332 1002605339
Species Human (GRCh38) Human (GRCh38)
Location 5:180379749-180379771 5:180379791-180379813
Sequence CCCTCGGTGCACGGTGTGTGTTT AAGCCTGAGCACTGTGAGCGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!