ID: 1002626301_1002626309 |
View in Genome Browser |
Spacer: 21 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1002626301 | 1002626309 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:180531816-180531838 | 5:180531860-180531882 |
| Sequence | CCACCAAAAAATGCAAGAACCAG | TGCAATCCCAGGCACTCTGCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 28, 1: 238, 2: 944, 3: 954, 4: 12510} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||