ID: 1002640789_1002640796

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1002640789 1002640796
Species Human (GRCh38) Human (GRCh38)
Location 5:180629695-180629717 5:180629732-180629754
Sequence CCTGCTTCCCTGGGTAGTCCCAG TGAGTTAAACTCAGCCCACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 380} {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!