ID: 1002642621_1002642624

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1002642621 1002642624
Species Human (GRCh38) Human (GRCh38)
Location 5:180637499-180637521 5:180637536-180637558
Sequence CCAGTCTTTGCTATGCAATCATC TTTGTTTGTTTGTTTTGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 168} {0: 1837, 1: 1336, 2: 2541, 3: 99899, 4: 82611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!