ID: 1002644553_1002644559

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1002644553 1002644559
Species Human (GRCh38) Human (GRCh38)
Location 5:180646725-180646747 5:180646762-180646784
Sequence CCGAACAGGCACTATGCTGGGGT CAGGCTCCTTCCCTGGGTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103} {0: 1, 1: 0, 2: 0, 3: 30, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!