ID: 1002660016_1002660027

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1002660016 1002660027
Species Human (GRCh38) Human (GRCh38)
Location 5:180785509-180785531 5:180785554-180785576
Sequence CCCCAGAACCCTCCAGCAAGGGG CATGAACTCCCTGGAGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 234} {0: 1, 1: 0, 2: 2, 3: 24, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!