ID: 1002662720_1002662732

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1002662720 1002662732
Species Human (GRCh38) Human (GRCh38)
Location 5:180802679-180802701 5:180802708-180802730
Sequence CCAGGTCCTCCCGACGTCCTGGC CTTGGCCTGCTCCGGGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 600} {0: 1, 1: 0, 2: 0, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!