ID: 1002662722_1002662732

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1002662722 1002662732
Species Human (GRCh38) Human (GRCh38)
Location 5:180802688-180802710 5:180802708-180802730
Sequence CCCGACGTCCTGGCCCCGAACTT CTTGGCCTGCTCCGGGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 54} {0: 1, 1: 0, 2: 0, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!