ID: 1002697407_1002697413

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1002697407 1002697413
Species Human (GRCh38) Human (GRCh38)
Location 5:181100201-181100223 5:181100217-181100239
Sequence CCAGGGCTTGCAGGCCATCTGGA ATCTGGAAAACTGGGGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 228} {0: 1, 1: 0, 2: 1, 3: 26, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!