ID: 1002719303_1002719305

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1002719303 1002719305
Species Human (GRCh38) Human (GRCh38)
Location 5:181247944-181247966 5:181247961-181247983
Sequence CCAGAGGGCCTGCTGACTGCCAG TGCCAGCTAAAACTCTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 299} {0: 1, 1: 0, 2: 0, 3: 8, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!