ID: 1002772898_1002772910

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1002772898 1002772910
Species Human (GRCh38) Human (GRCh38)
Location 6:304415-304437 6:304452-304474
Sequence CCGGGCCCTAAACCCAGCGAGTC CACGGCCTTCCACAGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 0, 2: 1, 3: 12, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!