ID: 1002775951_1002775959

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1002775951 1002775959
Species Human (GRCh38) Human (GRCh38)
Location 6:327612-327634 6:327635-327657
Sequence CCTCTGTGCCAGGGCCATGCGCC TGTGTGCTGCTGGTGGTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 81, 4: 762}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!