ID: 1002790740_1002790749

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1002790740 1002790749
Species Human (GRCh38) Human (GRCh38)
Location 6:435800-435822 6:435840-435862
Sequence CCGGGACTTGCGGGCCAACTGGC CCCCCGAGCCCACGCCCACCCGG
Strand - +
Off-target summary No data {0: 4, 1: 107, 2: 737, 3: 612, 4: 659}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!