ID: 1002804302_1002804311

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1002804302 1002804311
Species Human (GRCh38) Human (GRCh38)
Location 6:557706-557728 6:557746-557768
Sequence CCCAAGACTGTGAGAACATTGAT AAGAGGGACCAGCCCTTTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!