ID: 1002815024_1002815027

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1002815024 1002815027
Species Human (GRCh38) Human (GRCh38)
Location 6:671560-671582 6:671603-671625
Sequence CCTATATCATTTTGCTTCTCCCT TTAACTTCTTTTAATAGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 41, 3: 164, 4: 512} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!