ID: 1002837237_1002837244

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1002837237 1002837244
Species Human (GRCh38) Human (GRCh38)
Location 6:875147-875169 6:875186-875208
Sequence CCCACTGCACTCTAGAAAAGGTG CTTGCTACGTTGCCTTTTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!