ID: 1002885370_1002885380

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1002885370 1002885380
Species Human (GRCh38) Human (GRCh38)
Location 6:1289323-1289345 6:1289343-1289365
Sequence CCATCTTCCCTAAAGCAGGACAG CAGGTGCCAAGGGGGACATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 386} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!