ID: 1002887886_1002887901

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1002887886 1002887901
Species Human (GRCh38) Human (GRCh38)
Location 6:1312250-1312272 6:1312298-1312320
Sequence CCGGCACCATTTCCGTGCCCCGA GCCAGTGAAGAACCCCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 58} {0: 1, 1: 0, 2: 3, 3: 11, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!