ID: 1002898824_1002898834

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1002898824 1002898834
Species Human (GRCh38) Human (GRCh38)
Location 6:1393963-1393985 6:1393994-1394016
Sequence CCCCCTCCAGCCTGGGGCTACCT CCTCGCGCTGCCAGATGCTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 392} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!