ID: 1002935365_1002935370

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1002935365 1002935370
Species Human (GRCh38) Human (GRCh38)
Location 6:1667090-1667112 6:1667133-1667155
Sequence CCATTGACTCAATGAGGACAGCT TAGGGTTCTATAGAAGAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!