ID: 1002948698_1002948699

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1002948698 1002948699
Species Human (GRCh38) Human (GRCh38)
Location 6:1787244-1787266 6:1787263-1787285
Sequence CCAGTCAGAAAAATGAGCGAGAC AGACATAAAACAAAGTATAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 88, 4: 794}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!