ID: 1002952374_1002952375

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1002952374 1002952375
Species Human (GRCh38) Human (GRCh38)
Location 6:1826983-1827005 6:1827003-1827025
Sequence CCTGAGCGTAGGAGTTCAAGGTT GTTACAGTGAGCTATGATTGTGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 90, 3: 619, 4: 2736} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!