ID: 1003030723_1003030730

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1003030723 1003030730
Species Human (GRCh38) Human (GRCh38)
Location 6:2598212-2598234 6:2598238-2598260
Sequence CCTCTAGATGCTATACCGCACTT CCACGTAGAAACAGCTCCGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!