ID: 1003035856_1003035862

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003035856 1003035862
Species Human (GRCh38) Human (GRCh38)
Location 6:2639728-2639750 6:2639765-2639787
Sequence CCAGATCACCTCCTCATTTAGAG GAGAGATGACATGCCAAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 100} {0: 1, 1: 0, 2: 2, 3: 23, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!