ID: 1003038342_1003038355

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1003038342 1003038355
Species Human (GRCh38) Human (GRCh38)
Location 6:2664455-2664477 6:2664484-2664506
Sequence CCCCAGCACACGCATGCACACTG GTGCTGCGTGGCTGGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 303} {0: 1, 1: 0, 2: 8, 3: 132, 4: 2917}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!