|
Left Crispr |
Right Crispr |
| Crispr ID |
1003043808 |
1003043813 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:2714336-2714358
|
6:2714363-2714385
|
| Sequence |
CCTCAATTTGCATTAACTCACCC |
ATTTGCATGTAATTGAAAGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 10, 2: 20, 3: 30, 4: 137} |
{0: 26, 1: 115, 2: 189, 3: 287, 4: 465} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|