ID: 1003044885_1003044888

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1003044885 1003044888
Species Human (GRCh38) Human (GRCh38)
Location 6:2724587-2724609 6:2724638-2724660
Sequence CCTTCAGACTTTTATGATCAGTT CTCCAAAGTGCATTTCTTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194} {0: 1, 1: 0, 2: 1, 3: 24, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!