ID: 1003064852_1003064864

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1003064852 1003064864
Species Human (GRCh38) Human (GRCh38)
Location 6:2895221-2895243 6:2895257-2895279
Sequence CCGTGAAATTAGAGGGGGCGGAG GTGGGTGAGGAGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79} {0: 1, 1: 1, 2: 48, 3: 491, 4: 4065}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!