ID: 1003065963_1003065972

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1003065963 1003065972
Species Human (GRCh38) Human (GRCh38)
Location 6:2903550-2903572 6:2903586-2903608
Sequence CCCCGGCGCCAGGGCCTCTTCAG ACCTGACAGCCCAGAGAAGTAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 22, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!