ID: 1003074571_1003074575

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1003074571 1003074575
Species Human (GRCh38) Human (GRCh38)
Location 6:2971697-2971719 6:2971710-2971732
Sequence CCGCCAGCCGGAGGGGCCGCGAG GGGCCGCGAGTCCTGCCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147} {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!