|
Left Crispr |
Right Crispr |
| Crispr ID |
1003079619 |
1003079623 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:3010716-3010738
|
6:3010744-3010766
|
| Sequence |
CCAAAGGAGATGCCAAACCAGAG |
GTTCAGCAGCACCACACTGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 28, 2: 41, 3: 72, 4: 245} |
{0: 8, 1: 25, 2: 30, 3: 63, 4: 258} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|