ID: 1003080283_1003080292

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1003080283 1003080292
Species Human (GRCh38) Human (GRCh38)
Location 6:3016015-3016037 6:3016060-3016082
Sequence CCCCCTTGAGCATCATGTGCCTG ACCCACGTGGCAGGATGAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 53, 4: 1541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!