ID: 1003095938_1003095945

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003095938 1003095945
Species Human (GRCh38) Human (GRCh38)
Location 6:3143728-3143750 6:3143765-3143787
Sequence CCCAAAGGAGGTCACACTCTGAG GATCTAAGCATATCAATATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 253} {0: 1, 1: 0, 2: 1, 3: 13, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!