ID: 1003110910_1003110912

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1003110910 1003110912
Species Human (GRCh38) Human (GRCh38)
Location 6:3251490-3251512 6:3251531-3251553
Sequence CCGTGCTTCATCTGCAATTGCAG GTCCTGCCCGAGTGATCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 216} {0: 1, 1: 0, 2: 0, 3: 12, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!