ID: 1003116441_1003116460

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1003116441 1003116460
Species Human (GRCh38) Human (GRCh38)
Location 6:3286814-3286836 6:3286866-3286888
Sequence CCAGCTTCCCTCCCTGCACCCAG GAGGCCGAGCTGCAGGAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 114, 4: 1030} {0: 1, 1: 0, 2: 2, 3: 42, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!