ID: 1003121264_1003121269

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1003121264 1003121269
Species Human (GRCh38) Human (GRCh38)
Location 6:3320598-3320620 6:3320636-3320658
Sequence CCCTCTCCACAGCGGGCCACTTC ACAGAGCCCACTGCAGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 137} {0: 1, 1: 0, 2: 1, 3: 31, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!