ID: 1003123926_1003123936

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1003123926 1003123936
Species Human (GRCh38) Human (GRCh38)
Location 6:3340125-3340147 6:3340156-3340178
Sequence CCAGGAGGGATGGCCTGGAGAAG AAGGGCAGGGGCTTTGAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 321} {0: 1, 1: 0, 2: 2, 3: 43, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!